ARCHIVE - The Science Behind Intelligent Design Theory-by Casey Luskin

[Prisca]

From arrowheads to flagellum...

From arrowheads to flagellum...

If we can determine that there is a dividing line between an arrowhead that might have been the product of natural processes and one that is obviously the product of ID, perhaps we can move on to biological systems. (The arrowhead, after all, is not a part of a functioning system until it is put into use by the arrow-maker himself.)
So, let’s look at a biological system. Lion mentioned the flagellum found on some bacteria:

Does the flagellum display MLC (machine-like complexity as described by Warren) or does it not? If so, does this MLC infer ID?

 

[ThinkerThinker]

Originally posted by Warren
If a critic finds the current blind watchmaker inadequate to explain everything that's occurred in natural history, his only permissible move within science is to suggest a better blind watchmaker. That a competent blind watchmaker may not exist at all and that certain aspects of biotic reality may be better explained by a seeing watchmaker is not a logical possibility. Thus, most scientists don't investigate to determine IF life evolved, they only search for ways life DID evolve. Now, why should it be surprising to materialists that non-materialists remain skeptical of the current blind watchmaker hypothesis and feel that evidence for a seeing watchmaker may not be getting a fair hearing?

Both the scientist and the religious person have to base their initial assumption about the world on believes. The question is how far to we extend these believes. The scientist sets his or her marker as short as possible. In other words the scientists believes are as close to the available proves as possible so that he or she can say it is probable that we might eventually fill in the gabs and not have to believe anymore. This is a very uncomfortable position for the scientist and the stress that this creates drives the need for answers.

The religious person prefers not to exist in this stressful situation. He or she extends the belief as far as it needs to go to answer any question. The problem with this is that the need for answers is diminished because they presuppose they have the answer already. With such an outlook we would have had a different world today. I am not saying we would not have had scientific discovery but such discovery would have been driven by the unintentional discovery of contradictions.

TT

 

[ThinkerThinker]

Re: From arrowheads to flagellum...

Re: From arrowheads to flagellum...

Originally posted by Becky

If we can determine that there is a dividing line between an arrowhead that might have been the product of natural processes and one that is obviously the product of ID, perhaps we can move on to biological systems.

I think when we attempt to find the line between what was designed by intelligence and what is natural we should not look at extreme examples but at those that fall on the border.

There first have to be enough knowledge of what we term natural. We term something as designed by intelligence if it deviates from this base knowledge in terms of form, function or structure.

Eg. We have a base knowledge of what geometric forms a set of objects can possible form in nature. If we see three stones set in a perfect triangle we are not sure if they were placed there naturally or by intelligent design because our base knowledge dictates it is possible for nature to form such a shape. When we find six stones placed in a perfect hexagon the probability shifts more toward it being placed there by an intelligence and when we find two hundred stones in a perfect circle it has such a high probability that it was placed there by intelligence that we feel sure it was by intelligence.

If we did not have a base knowledge that snowflakes were a natural occurrence we would have had to assume it was a produced by intelligence. In the same context, if we were to go to another planet and found something there which we assume was produced by an intelligence that assumption would be based on our knowledge of what is natural on earth and of what we have alreay discoverd on other planets in our solar system. It will not take into account natural processes of which we have no knowledge. Once we discover these hypothetical processes, we will then be in a posibion to revise our assumptions.

As our base knowledge increases the line between what is natural and what is produced by intelligence becomes more refined. That is why the question whether the human mind was produced by intelligence is still unclear. My BELIEF is that, as we discover more about the biological processes involved and what exactly the mind and intelligence is we will see that it IS a natural process but for now it is still a belief. The reason why I think it is a better belief to hold than believing it was produced by a higher intelligence is answered in my previous post.

TT

 

[Prisca]

TT

TT

You said, “I think when we attempt to find the line between what was designed by intelligence and what is natural we should not look at extreme examples but at those that fall on the border.”

TT, that was the point (no pun intended) of the first picture I posted. Remember? The one that was posted over and over again? In fact, here it is again:

Now the likelihood is that both of these are examples of ID. However, the one on the right seems to have a higher probability of being the product of ID than the one on the left, and both have a higher probability than the one posted by you. But there is no doubt that this…

is anything BUT the product of ID.

So, lets put arrowheads behind us and try to determine if this…

has the earmarks of ID or not.

 

[ThinkerThinker]

Re: TT

Re: TT

Originally posted by Becky
So, lets put arrowheads behind us and try to determine if this…

has the earmarks of ID or not.

I'm not sure what the point is. According to my definition the image above represents an object with a extremely high probability of being designed by an intelligence. In fact, so high I would be willing to say it was definitly designed by intelligence.

So?

TT

 

[Prisca]

TT

TT

You said, “According to my definition the image above represents an object with a extremely high probability of being designed by an intelligence. In fact, so high I would be willing to say it was definitly designed by intelligence.

So?”

So? You do realize that this is a bacterial flagella, right?

 

[Prisca]

How about this?

How about this?

I found this animated version...

Did you know that the Bacterial Flagellum requires over 50 different, separate  protein parts for operation?

Pretty amazing!

 

[KurtPh]

Yep, the natural world and evoluton are pretty remarkable.

 

[Vann]

Just rhetoric?

Just rhetoric?

Becky,
Though your example is clever, it is more rhetorical than anything else. Whether or not anyone thinks that is designed by something intelligent is irrelevant in most every regard except to discover one's natural biases.

*Please note: I'm neither supporting or denying the validity of ID or evolution or anything else other than Becky's example. Any comment inferring otherwise is incorrect in its assumptions.

 

[JGaltJr.]

I would say from Becky's example it'd be easy to assume intelligent design. Of course it's also be easy to look at the earth and assume it's flat.

 

[Prisca]

KurtPh

KurtPh

You said, “Yep, the natural world and evoluton are pretty remarkable.”

Kurt, you must have incredible faith to believe that biological structures, such as the one above, came about by chance. If that is where you choose to place your faith, then so be it. Please realize though, that those of us who don’t believe as you do, have valid reasons for believing what we do.

***********************************************

Prov. 26:10 The great God who formed everything Gives the fool his hire and the transgressor his wages.

 

[JGaltJr.]

What kind of valid reasons? And there really is no need to stoop to the level of claiming that non-belief is a faith based system.

 

[Prisca]

Vann

Vann

You said, “Though your example is clever, it is more rhetorical than anything else. Whether or not anyone thinks that is designed by something intelligent is irrelevant in most every regard except to discover one's natural biases.”

Why would you come to this conclusion? How could the study of the origins of biological structures be irrelevant? Seems to me there is a double standard when it comes to those who interested in ID. Are scientists not looking for signs of intelligence elsewhere in the universe? In fact, over $150 million has been spent on just such a prospect.

Yet..,

"...An intelligible communication via radio signal from some distant galaxy would be widely hailed as evidence of an intelligent source. Why then doesn't the message sequence on the DNA molecule also constitute prima facie evidence for an intelligent source? After all, DNA information is not just analogous to a message sequence such as Morse code, it is such a message sequence."
(Charles B Thaxton, Walter L Bradley and Robert L Olsen: The Mystery of Life's Origin, Reassessing Current Theories (New York Philosophical Library 1984) pp 211-212)

 

[Prisca]

JGaltJr.

JGaltJr.

You said, “I would say from Becky's example it'd be easy to assume intelligent design. Of course it's also be easy to look at the earth and assume it's flat.”

If you can explain the logic behind this kind of reasoning, then perhaps you deserve more credit than I am willing to give you at this point. For now, I can only assume that you have no understanding of the principles of science or logic.

Then you said, “And there really is no need to stoop to the level of claiming that non-belief is a faith based system.”

I was referring to Kurt’s faith in naturalistic processes and evolution. He said nothing about non-belief. Perhaps you need to re-read his comment.

 

[JGaltJr.]

Becky you're starting to sound like your brother. Is the condescension really necessary? I specifically asked, "What kind of valid reasons" and you ignored this in favor of this "For now, I can only assume that you have no understanding of the principles of science or logic."

Care to answer my question or not?

 

[ThinkerThinker]

Re: TT

Re: TT

Originally posted by Becky
So? You do realize that this is a bacterial flagella, right?

Yes, I do realise it is bacterial flagella. My point is best illustrated in this way.

for (i=1; typeof _root["p"+i] == "movieclip"; i++) {
if (_root["p"+i].hitTest(_root.runner1) == true) {
_root.score += (_root["p"+i].points)*3;
_root.graph.bar1._yscale += (_root["p"+i].points)*3;
_root["p"+i].points = 0;
_root["p"+i].play();
}
}

Among other things I am a programmer. When a non-programmer look at my code they are baffled by the incredible complexity of what they observe with no way of understanding what it means. When I look at it I see elegant simplicity of logic based on a few elementary rules. The complexity does no lie in the syntax, which is very simple, the complexity lies in the volume of parts and the way they relate and affect each other.

The key is lack understanding. If I have no understanding of the "syntax" of evolution then bacterial flagella will look incredibly complex to me and I will make the assumption that is was designed by intelligence. The more likely truth is that once I understand the "syntax" I will probably see the elegant simplicity of logic by which the bacterial flagella developed naturally.

There is still a vast amount of information we do not know yet. The danger of believing God did it all is that we would probably never find out what that information means and progress will be crippled and with that the benefits we might receive from it.

I much prefer the idea that, if there is a God, he did it all at the Big Bang and from there it is all natural.

TT

 

[ThinkerThinker]

Yet..,
Quote:"...An intelligible communication via radio signal from some distant galaxy would be widely hailed as evidence of an intelligent source. Why then doesn't the message sequence on the DNA molecule also constitute prima facie evidence for an intelligent source? After all, DNA information is not just analogous to a message sequence such as Morse code, it is such a message sequence." (Charles B Thaxton, Walter L Bradley and Robert L Olsen: The Mystery of Life's Origin, Reassessing Current Theories (New York Philosophical Library 1984) pp 211-212)

Radio signals that contains a messages from which one can deduce intelligible communication is hardly the same as DNA information in the context of proving ID. Although structural principle the might have the same basis (i.e. coded) the proof of ID is not in the structural principle but in the change from what we know to be natural. Remember this quote:

ThinkerThinker wrote: There first have to be enough knowledge of what we term natural. We term something as designed by intelligence if it deviates from this base knowledge in terms of form, function or structure. (see one of my previous posts)

So, because natural radio signals does not, in our experience, carry messages containing the Pythagorean theory it has a very high probability that it is from an intelligence if it does.

To say DNA information is a message sequence is contextually wrong if used in the context of communication via radio signals. You should then say DNA information is an information sequence.

TT

 

[Prisca]

JGaltJr.

JGaltJr.

First of all, you said, “I would say from Becky's example it'd be easy to assume intelligent design. Of course it's also be easy to look at the earth and assume it's flat.”

You expect me to ignore this illogical attack? You are trying to equate my reasoning that the flagellum displays MLC with the belief in a flat earth. Instead, why not give your own valid reasons for why you think the flagellum is not a product of ID? You are probably a smart guy, but using ad hominem attacks to try and discredit me is not the way to show it.

You asked, “Care to answer my question or not?”

If you can agree to have a logical discussion, then maybe it would be worth my time. For now, I think I’ll reserve my statements for TT who seems to have a better handle on the information at hand. Thanks anyway.

 

[Prisca]

TT

TT

You said, “Yes, I do realise it is bacterial flagella. My point is best illustrated in this way.”

I thought you did, but your statement surprised me.

Now concerning the code you posted, you said…

“When I look at it I see elegant simplicity of logic based on a few elementary rules. The complexity does no[t] lie in the syntax, which is very simple, the complexity lies in the volume of parts and the way they relate and affect each other.”

Exactly! The way the parts relate to and affect each other is vital. Now I am not a programmer, so I may be off base here, but would your code “work” or make sense if it were changed? For example, does this still make sense?

for (i1; typeof _root["p"+i] "movieclip"; i++) {
if (_root["p"+i].hitTest(_root.runner1) true) {
_root.score (_root["p"+i].points)*3;
_root.graph.bar1._yscale (_root["p"+i].points)*3;
_root["p"+i].points 0;
_root["p"+i].play();
}
}

How would the changes I made affect the outcome of the code? Would it still function? (For example, when you take the verb out of a sentence, you no longer have a sentence-you only have a fragment) I did a tiny bit of programming back when I had a Commodore 64, lol, and one little mistake in the code and my program did not function correctly. As far as genetics are concerned, a small change or mutation can have catastrophic effects on the organism. In the case of the flagellum, if we take away the paddle, the rotor, or the motor, it no longer functions as a swimming mechanism. How then, did each of these “highly tailored” parts happen to come together?

You said, “There is still a vast amount of information we do not know yet. The danger of believing God did it all is that we would probably never find out what that information means and progress will be crippled and with that the benefits we might receive from it.

Believing that God did something does not cause the scientist to throw up his hands and give up! History shows us that it is quite the contrary. ID theory does not cripple anything. It is merely an attempt to understand the complexity we see before us.

You said, “I much prefer the idea that, if there is a God, he did it all at the Big Bang and from there it is all natural.”

Why would you prefer such an idea?

 

[Prisca]

TT

TT

You said, “To say DNA information is a message sequence is contextually wrong if used in the context of communication via radio signals. You should then say DNA information is an information sequence.”

Message, signal, code, information sequence… they all inform or instruct in some way, correct? Sounds like semantics to me.

“The genetic code is the language used by living cells to convert information found in DNA into information needed to make proteins. A protein's structure, and therefore function, is determined by the sequence of amino acid subunits. The amino acid sequence of a protein is determined by the sequence of the gene encoding that protein. The "words" of the genetic code are called codons. Each codon consists of three adjacent bases in an mRNA molecule. Using combinations of A, U, C and G, there can be sixty four different three-base codons. There are only twenty amino acids that need to be coded for by these sixty four codons. This excess of codons is known as the redundancy of the genetic code. By allowing more than one codon to specify each amino acid, mutations can occur in the sequence of a gene without affecting the resulting protein.”

Just for fun, decode the following:
TTGAGAACAGCAATGGCAACGACAATGGATACAGTAGTAACCAGAACATGG
at http://www.dna2z.com/DNA-o-gram/decode.html
Make sure you enter it carefully - copy and paste is the best way.